A telomere is a region of repetitive DNA at the end of a chromosome, which protects the end of the chromosome from deterioration. Its name is derived from the Greek nouns telos (τἐλος) "end" and merοs (μέρος, root: μερ-) "part".
Russian theorist Alexei Olovnikov was the first to recognize (1971) the problem of how chromosomes could replicate right to the tip, as such was impossible with replication in a 5' to 3' direction. To solve this and to accommodate Leonard Hayflick's idea of limited somatic cell division, Olovnikov suggested that DNA sequences would be lost in every replicative phase until they reached a critical level, at which point cell division would stop.[1][2]
During cell division, enzymes that duplicate the chromosome and its DNA cannot continue their duplication all the way to the end of the chromosome. If cells divided without telomeres, they would lose the ends of their chromosomes, and the necessary information they contain. (In 1972, James Watson named this phenomenon the "end replication problem".) The telomeres are disposable buffers blocking the ends of the chromosomes and are consumed during cell division and replenished by an enzyme, the telomerase reverse transcriptase.
They have been likened to the aglets (tips) on the ends of shoelaces that keep them from fraying.[3]
In 1975–1977, Elizabeth Blackburn, working as a postdoctoral fellow at Yale University with Joseph Gall, discovered the unusual nature of telomeres, with their simple repeated DNA sequences composing chromosome ends. Their work was published in 1978. The telomere shortening mechanism normally limits cells to a fixed number of divisions, and animal studies suggest that this is responsible for aging on the cellular level and sets a limit on lifespans. Telomeres protect a cell's chromosomes from fusing with each other or rearranging—abnormalities which can lead to cancer—and so cells are normally destroyed when their telomeres are consumed. Most cancers are the result of "immortal" cells which have ways of evading this programmed destruction.[4]
Elizabeth Blackburn, Carol Greider, and Jack Szostak were awarded the 2009 Nobel Prize in Physiology or Medicine for the discovery of how chromosomes are protected by telomeres and the enzyme telomerase.[5]
Telomeres are repetitive DNA sequences located at the termini of linear chromosomes of most eukaryotic organisms, and a few prokaryotes. Telomeres compensate for incomplete semi-conservative DNA replication at chromosomal ends. The protection against homologous recombination (HR) and non-homologous end joining (NHEJ) constitutes the essential “capping” role of telomeres that distinguishes them from DNA double-strand breaks (DSBs) (Lundblad, 2000; Ferreira et al., 2004).
In most prokaryotes, chromosomes are circular and thus do not have ends to suffer premature replication termination. A small fraction of bacterial chromosomes (such as those in Streptomyces and Borrelia) are linear and possess telomeres, which are very different from those of the eukaryotic chromosomes in structure and functions. The known structures of bacterial telomeres take the form of proteins bound to the ends of linear chromosomes, or hairpin loops of single-stranded DNA at the ends of the linear chromosomes.[6]
In most multicellular eukaryotic organisms, telomerase is active only in germ cells, stem cells and certain white blood cells. There are theories that the steady shortening of telomeres with each replication in somatic (body) cells may have a role in senescence and in the prevention of cancer. This is because the telomeres act as a sort of time-delay "fuse", eventually running out after a certain number of cell divisions and resulting in the eventual loss of vital genetic information from the cell's chromosome with future divisions.
Telomere length varies greatly between species, from approximately 300 to 600 base pairs in yeast (Shampay et al., 1984) to many kilobases in humans, and usually is composed of arrays of guanine-rich, six-to-eight base-pair-long repeats. Eukaryotic telomeres normally terminate with 3′ single-stranded-DNA overhang which is essential for telomere maintenance and capping. Multiple proteins binding single- and double-stranded telomere DNA have been identified (Blackburn, 2001; Smogorzewska and de Lange, 2004; Cech, 2004; De Lange et al., 2005; Kota and Runge, 1999). These function in both telomere maintenance and capping. Telomeres form large loop structures called telomere loops, or T-loops. Here, the single-stranded DNA curls around in a long circle stabilized by telomere-binding proteins.[[7]] At the very end of the T-loop, the single-stranded telomere DNA is held onto a region of double-stranded DNA by the telomere strand disrupting the double-helical DNA and base pairing to one of the two strands. This triple-stranded structure is called a displacement loop or D-loop.[[8]]
Telomere shortening in humans can induce replicative senescence which blocks cell division. This mechanism appears to prevent genomic instability and development of cancer in human aged cells by limiting the number of cell divisions. Malignant cells which bypass this arrest become immortalized by telomere extension mostly due to the activation of telomerase, the reverse transcriptase enzyme responsible for synthesis of telomeres. However, 5–10% of human cancers activate the Alternative Lengthening of Telomeres (ALT) pathway which relies on recombination-mediated elongation.
Human somatic cells lacking telomerase gradually lose telomeric sequences as a result of incomplete replication (Counter et al., 1992). As human telomeres grow shorter, eventually cells reach the limit of their replicative capacity and progress into senescence. Senescence involves p53 and pRb pathways and leads to the arrest of cell proliferation (Campisi, 2005). It is thought that senescence plays an important role in suppression of emergence of cancer. However, further cell proliferation can be achieved by inactivation of p53 and pRb pathways. Cells entering proliferation after inactivation of p53 and pRb pathways undergo crisis. Crisis is characterized by gross chromosomal rearrangements and genome instability, and almost all cells die. Rare cells emerge from crisis immortalized through telomere elongation by either activated telomerase or ALT (Colgina and Reddel, 1999; Reddel and Bryan, 2003). The first description of an ALT cell line demonstrated that the telomeres were highly heterogeneous in length and predicted a mechanism involving recombination (Murnane et al., 1994). Subsequent studies have confirmed a role for recombination in telomere maintenance by ALT (Dunham et al., 2000), however, the exact mechanism of this pathway is yet to be determined. ALT cells produce abundant t-circles, possible products of intratelomeric recombination and t-loop resolution (Tomaska et al., 2000; 2009; Cesare and Griffith, 2004; Wang et al., 2004).
Telomerase is a "ribonucleoprotein complex" composed of a protein component and an RNA primer sequence which acts to protect the terminal ends of chromosomes. The actions of telomerase are necessary because, during replication, DNA polymerase can only synthesize DNA in a 5' to 3' direction and can only do so by adding polynucleotides to an RNA primer that has already been placed at various points along the length of the DNA. These RNA strands must later be replaced with DNA. This replacement of the RNA primers is not a problem at origins of replication within the chromosome because DNA polymerase can use a previous stretch of DNA 5' to the RNA template as a template to backfill the sequence where the RNA primer was; at the terminal end of the chromosome, however, DNA polymerase cannot replace the RNA primer because there is no position 5' of the RNA primer where another primer can be placed nor is there DNA upstream that can be used as a primer so that DNA polymerase can replace the RNA primer. Without telomeres at the end of DNA, this genetic sequence at the end of the chromosome would be deleted and the chromosome would grow shorter and shorter in subsequent replications. The telomere prevents this problem by employing a different mechanism to synthesize DNA at this point, thereby preserving the sequence at the terminal of the chromosome. This prevents chromosomal fraying and prevents the ends of the chromosome from being processed as a double strand DNA break, which could lead to chromosome-to-chromosome telomere fusions. Telomeres are extended by telomerases, part of a protein subgroup of specialized reverse transcriptase enzymes known as TERT (TElomerase Reverse Transcriptases) that are involved in synthesis of telomeres in humans and many other, but not all, organisms. However, because of DNA replication mechanisms, oxidative stress, and because TERT expression is very low in many types of human cells, the telomeres of these cells shrink a little bit every time a cell divides although in other cellular compartments which require extensive cell division, such as stem cells and certain white blood cells, TERT is expressed at higher levels and telomere shortening is partially or fully prevented.
In addition to its TERT protein component, telomerase also contains a piece of template RNA known as the TERC (TElomerase RNA Component) or TR (Telomerase RNA). In humans, this TERC telomere sequence is a repeating string of TTAGGG, between 3 and 20 kilobases in length. There are an additional 100-300 kilobases of telomere-associated repeats between the telomere and the rest of the chromosome. Telomere sequences vary from species to species, but generally one strand is rich in G with fewer Cs. These G-rich sequences can form four-stranded structures (G-quadruplexes), with sets of four bases held in plane and then stacked on top of each other with either a sodium or potassium ion between the planar quadruplexes.
If telomeres become too short, they will potentially unfold from their presumed closed structure. It is thought that the cell detects this uncapping as DNA damage and then enters cellular senescence, growth arrest or apoptosis, depending on the cell's genetic background (p53 status). Uncapped telomeres also result in chromosomal fusions. Since this damage cannot be repaired in normal somatic cells, the cell may even go into apoptosis. Many aging-related diseases are linked to shortened telomeres. Organs deteriorate as more and more of their cells die off or enter cellular senescence.
At the very distal end of the telomere is a 300 bp single-stranded portion which forms the T-Loop. This loop is analogous to a 'knot' which stabilizes the telomere, preventing the telomere ends from being recognized as break points by the DNA repair machinery. Should non-homologous end joining occur at the telomeric ends, chromosomal fusion will result. The T-loop is held together by seven known proteins; most notably TRF1, TRF2, POT1, TIN1, and TIN2, collectively referred to as the shelterin complex.
A study published in the May 3, 2005 issue of the American Heart Association journal Circulation found that weight gain and increased insulin resistance were correlated with greater telomere shortening over time.
Telomeres shorten in part because of the end replication problem that is exhibited during DNA replication in eukaryotes only. Because DNA replication does not begin at either end of the DNA strand, but starts in the center, and considering that all DNA polymerases that have been discovered move in the 5' to 3' direction, one finds a leading and a lagging strand on the DNA molecule being replicated.
On the leading strand, DNA polymerase can make a complementary DNA strand without any difficulty because it goes from 5' to 3'. However, there is a problem going in the other direction on the lagging strand. To counter this, short sequences of RNA acting as primers attach to the lagging strand a short distance ahead of where the initiation site was. The DNA polymerase can start replication at that point and go to the end of the initiation site. This causes the formation of Okazaki fragments. More RNA primers attach further on the DNA strand and DNA polymerase comes along and continues to make a new DNA strand.
Eventually, the last RNA primer attaches, and DNA polymerase, RNA nuclease and DNA ligase come along to convert the RNA (of the primers) to DNA and to seal the gaps in between the Okazaki fragments. But in order to change RNA to DNA, there must be another DNA strand in front of the RNA primer. This happens at all the sites of the lagging strand, but it does not happen at the end where the last RNA primer is attached. Ultimately, that RNA is destroyed by enzymes that degrade any RNA left on the DNA. Thus, a section of the telomere is lost during each cycle of replication at the 5' end of the lagging strand.
However, in vitro studies (von Zglinicki et al. 1995, 2000) have shown that telomeres are highly susceptible to oxidative stress. Telomere shortening due to free radicals explains the difference between the estimated loss per division because of the end-replication problem (ca. 20 bp) and actual telomere shortening rates (50-100 bp), and has a greater absolute impact on telomere length than shortening caused by the end-replication problem.
The phenomenon of limited cellular division was first observed by Leonard Hayflick, and is now referred to as the Hayflick limit. Significant discoveries were made by the team led by Professor Elizabeth Blackburn at the University of California, San Francisco (UCSF).
Advocates of human life extension promote the idea of lengthening the telomeres in certain cells through temporary activation of telomerase (by drugs), or possibly permanently by gene therapy. They reason that this would extend human life. So far these ideas have not been proven in humans.
However, it has been hypothesized that there is a trade-off between cancerous tumor suppression and tissue repair capacity, in that lengthening telomeres might slow aging and in exchange increase vulnerability to cancer (Weinstein and Ciszek, 2002).
A study done with the nematode worm species Caenorhabditis elegans indicates that there is a correlation between lengthening telomeres and a longer lifespan. Two groups of worms were studied which differed in the amount of the protein HRP-1 their cells produced, resulting in telomere lengthening in the mutant worms. The worms with the longer telomeres lived 24 days on average, about 20 percent longer than the normal worms.[9]
Techniques to extend telomeres could be useful for tissue engineering, because they might permit healthy, noncancerous mammalian cells to be cultured in amounts large enough to be engineering materials for biomedical repairs.
However, there are several issues that still need to be cleared up. First, it is not even certain whether the relationship between telomeres and aging is causal. Changing telomere lengths are usually associated with changing speed of senescence. This telomere shortening, however, might be a consequence of, and not a reason for, aging.
That the role of telomeres is far from being understood is demonstrated by two recent studies on long-lived seabirds. In 2003, scientists observed that the telomeres of Leach's Storm-petrel (Oceanodroma leucorhoa) seem to lengthen with chronological age, the first observed instance of such behaviour of telomeres.[10] In 2006, Juola et al.[11] reported that in another unrelated, long-lived seabird species, the Great Frigatebird (Fregata minor), telomere length did decrease until at least c.40 years of age (i.e. probably over the entire lifespan), but the speed of decrease slowed down massively with increasing ages, and that rates of telomere length decrease varied strongly between individual birds. They concluded that in this species (and probably in frigatebirds and their relatives in general), telomere length could not be used to determine a bird's age sufficiently well. Thus, it seems that there is much more variation in the behavior of telomere length than initially believed.
The telomere length varies in cloned animals. Sometimes the clones end up with shorter telomeres since the DNA has already divided countless times. Occasionally, the telomeres in a clone's DNA are longer because they get "reprogrammed".
UCLA confirmed a small-molecule extract from a plant, that turns on the expression of telomerase in human cell.[12]
In 2008, Dr. Dean Ornish of the Preventive Medicine Research Institute (Sausalito, CA) and colleagues at the University of California at San Francisco conducted a study of 30 men with low-risk prostate cancer on the possible effects of lifestyle changes on telomeres. The findings of the study were published in The Lancet Oncology. The men were asked to make several lifestyle changes, including attending a three-day retreat; eating a diet low in refined sugars and rich in whole foods, fruits, and vegetables, with only 10 percent of calories derived from fat; and engaging in several other activities, such as moderate aerobic exercise, relaxation techniques and breathing exercises. Telomerase levels were measured at baseline, and again after three months, when researchers discovered that, in the 24 participants with sufficient data for analysis, telomerase in the blood had increased by 29 percent. The authors commented that "The implications of this study are not limited to men with prostate cancer. Comprehensive lifestyle changes may cause improvements in telomerase and telomeres that may be beneficial to the general population as well." In a cautionary note due to the limited nature of the pilot study, the authors indicated the link between lifestyle changes and increases in telomerase activity was reported as "significant association rather than inferring causation" until wider studies are completed.[13][14]
Several techniques are currently employed to assess average telomere length in eukaryotic cells. The most widely used method is the Terminal Restriction Fragment (TRF) southern blot, which involves hybridization of a radioactive 32P-(TTAGGG)n oligonucleotide probe to Hinf / Rsa I digested genomic DNA embedded on a nylon membrane and subsequently exposed to autoradiographic film or phosphoimager screen. Another histochemical method, termed Q-FISH, involves fluorescent in situ hybridization (FISH). Q-FISH, however, requires significant amounts of genomic DNA (2-20 micrograms) and labor which renders its use limited in large epidemiological studies. Some of these impediments have been overcome with a Real-Time PCR assay for telomere length and Flow-FISH. RT-PCR assay involves determining the Telomere-to-Single Copy Gene (T/S)ratio, which is demonstrated to be proportional to the average telomere length in a cell. The Real-Time PCR assay has been since scaled up to high-throughput 384-well format use, making the assay feasible for use in large cohort studies. Flow-FISH is an adaptation of the Q-FISH telomere quantitation technique, which uses a flow cytometer to measure median fluorescence of a population of cells, thus reducing labor requirements and increasing reproducibility. Flow-FISH has been scaled up to the 96-well format.[15]
Another technique, referred to as single telomere elongation length analysis (STELA), was developed in 2003 by Duncan Baird. This technique is a PCR based technique. As a result, it is has a much higher resolution than previous telomere length analysis techniques. And because chromosome specific primers can be used, investigations can target specific telomere ends. This is something that is not possible with TRF analysis. However, due to this technique's being PCR-based, telomeres larger than 25Kb cannot be amplified and there is a bias towards shorter telomeres. This can be problematic when analysing ALT positive cell lines as these have very heterogeneous telomere lengths and can exhibit telomeres as large as 50Kb.
Group | Organism | Telomeric repeat (5' to 3' toward the end) |
---|---|---|
Vertebrates | Human, mouse, Xenopus | TTAGGG |
Filamentous fungi | Neurospora crassa | TTAGGG |
Slime moulds | Physarum, Didymium | TTAGGG |
Dictyostelium | AG(1-8) | |
Kinetoplastid protozoa | Trypanosoma, Crithidia | TTAGGG |
Ciliate protozoa | Tetrahymena, Glaucoma | TTGGGG |
Paramecium | TTGGG(T/G) | |
Oxytricha, Stylonychia, Euplotes | TTTTGGGG | |
Apicomplexan protozoa | Plasmodium | TTAGGG(T/C) |
Higher plants | Arabidopsis thaliana | TTTAGGG |
Green algae | Chlamydomonas | TTTTAGGG |
Insects | Bombyx mori | TTAGG |
Roundworms | Ascaris lumbricoides | TTAGGC |
Fission yeasts | Schizosaccharomyces pombe | TTAC(A)(C)G(1-8) |
Budding yeasts | Saccharomyces cerevisiae | TGTGGGTGTGGTG (from RNA template) or G(2-3)(TG)(1-6)T (consensus) |
Saccharomyces castellii | TCTGGGTG | |
Candida glabrata | GGGGTCTGGGTGCTG | |
Candida albicans | GGTGTACGGATGTCTAACTTCTT | |
Candida tropicalis | GGTGTA[C/A]GGATGTCACGATCATT | |
Candida maltosa | GGTGTACGGATGCAGACTCGCTT | |
Candida guillermondii | GGTGTAC | |
Candida pseudotropicalis | GGTGTACGGATTTGATTAGTTATGT | |
Kluyveromyces lactis | GGTGTACGGATTTGATTAGGTATGT |
As a measure of systemic telomere length, peripheral blood leukocyte telomere length is generally preferred. Systemic telomere length has been proposed as a marker of biological aging. A subject's systemic telomere length is predominantly genetically determined, but has several other known determinants: age (shorter telomeres in older people), paternal age at birth (longer telomeres in subjects with older fathers at their birth) and sex (shorter telomeres in men, probably due to a faster telomere attrition). Evidence suggests that elevated levels of oxidative stress and inflammation further increase the telomere attrition rate.[16]
Vitamin D may have an effect on peripheral blood leukocyte telomere length. Richards and coworkers examined whether vitamin D concentrations would slow the rate of shortening of leukocyte telomeres. The authors stated that vitamin D is a potent inhibitor of the proinflammatory response and slows the turnover of leukocytes. Leukocyte telomere length (LTL) predicts the development of aging-related disease, and the length of these telomeres decreases with each cell division and with increased inflammation. Researchers measured serum vitamin D concentrations in 2160 women, aged 18–79 years (mean age: 49.4), from a large population-based cohort of twins. This study divided the group into thirds, based on vitamin D levels, and found that increased age was significantly associated with shorter LTL (r = -0.40, P < 0.0001). Higher serum vitamin D concentrations were significantly associated with longer LTL (r = 0.07, P = 0.0010) and this finding persisted even after adjustment for age (r = 0.09, P < 0.0001) and other variables that independently could affect LTL (age, season of vitamin D measurement, menopausal status, use of hormone replacement therapy, and physical activity). The difference in LTL between the highest and lowest tertiles of vitamin D was highly significant (P = 0.0009) and the authors stated that this was equivalent to 5.0 years of aging. The authors concluded that higher vitamin D levels, easily modifiable through nutritional supplementation, were associated with longer LTL. This underscores the potentially beneficial effects of vitamin D on aging and age-related diseases.[17] Also, peer reviewed clinical studies indicate a relationship between regular exercise and the minimizing of telomere erosion in both mice and humans.[18]
As a cell begins to become cancerous, it divides more often and its telomeres become very short. If its telomeres get too short, the cell may die. It can escape this fate by becoming a cancer cell and activating an enzyme called telomerase, which prevents the telomeres from getting even shorter.
Studies have found shortened telomeres in many cancers, including pancreatic, bone, prostate, bladder, lung, kidney, and head and neck.
Measuring telomerase may be a new way to detect cancer. If scientists can learn how to stop telomerase, they might be able to fight cancer by making cancer cells age and die. In one experiment, researchers blocked telomerase activity in human breast and prostate cancer cells growing in the laboratory, prompting the tumor cells to die. But there are risks. Blocking telomerase could impair fertility, wound healing and production of blood cells and immune system cells.
Cancer cells require a mechanism to maintain their telomeric DNA in order to continue dividing indefinitely (immortalization). A mechanism for telomere elongation or maintenance is one of the key steps in cellular immortalization and can be used as a diagnostic marker in the clinic. Telomerase, the enzyme complex responsible for elongating telomeres, is activated in approximately 90% of tumors. However, a sizeable fraction of cancerous cells employ alternative lengthening of telomeres (ALT),[19] a non-conservative telomere lengthening pathway involving the transfer of telomere tandem repeats between sister-chromatids. The mechanism by which ALT is activated is not fully understood because these exchange events are difficult to assess in vivo.[20]
Telomerase is the natural enzyme which promotes telomere repair. It is however not active in most cells. It is active in stem cells, germ cells, hair follicles and in 90 percent of cancer cells. Telomerase functions by adding bases to the ends of the telomeres. As a result of this telomerase activity, these cells seem to possess a kind of immortality.
Studies using knockout mice have demonstrated that the role of telomeres in cancer can both be limiting to tumor growth, as well as promote tumorigenesis, depending on the cell type and genomic context.[21][22]
Shorter (systemic) telomere length has been suggested as an independent risk factor for cardiovascular disease. The origin of this association is unclear and several models have been proposed, particularly attributing the biomarker value to a genetic prediposition in subjects with shorter telomeres, to an effect of inflammation and oxidative stress or to a combination of both.[16]
A 2002 Japanese study found that an individual's age can be roughly estimated from the length of their telomeres, making it possible to determine the age of any forensic sample that contains well-preserved DNA.[23] Formerly, forensic scientists were forced to rely on morphological characteristics (such as the growth and decay of bones) to determine an individual's age.[24]
The telomeres of human cells have been found to have a unique histone modification pattern with the most enriched modifications being H2BK5me1 and H3K3me3 and the least enriched modifications being H3K36me3 and H3K9me3 [25]
|